Skip to Content
Merck
All Photos(1)

Documents

EHU042481

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCATCAGTTCGCTTAATGAATTCAATCCCATGGGGGACACGCTGGCCTCTGCAATGGGTTACCACATTCTCATCTGGAGCCAGGAGGAAGCCAGGACACGGAAGTGAGAGACACTAAAGAAGGTGTGGGCCAGACAAGGCCTTGGAGCCCACACATGGGATCAAGTCCTGCAAGCAGAGGTGGCGATTTGTTAAAGGGCCAAAAGTATCCAAGGTTAGGGTTGGAGCAGGGGTGCTGGGACCTGGGGCACTGTGGGACTGGGACACTTTTATGTTAATGCTCTGGACTTGCCTCCAGAGACTGCTCCAGAGTTGGTGACACAGCTGTCCCAAGGGCCCCTCTGTATCTAGCCTGGAACCAAGGTTATCTTGGAACTAAATGACTTTTCTCCTCTCAGTGGGTGG

Ensembl | human accession no.

ENSG00000134574

NCBI accession no.

NM_000107

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DDB2(1643) , DDB2(1643)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sunbok Jang et al.
Nature structural & molecular biology, 26(8), 695-703 (2019-07-25)
UV-DDB, a key protein in human global nucleotide excision repair (NER), binds avidly to abasic sites and 8-oxo-guanine (8-oxoG), suggesting a noncanonical role in base excision repair (BER). We investigated whether UV-DDB can stimulate BER for these two common forms
Qianzheng Zhu et al.
Mutation research, 776, 16-23 (2015-08-11)
Acetylated histone H3 lysine 56 (H3K56Ac) is one of the reversible histone post-translational modifications (PTMs) responsive to DNA damage. We previously described a biphasic decrease and increase of epigenetic mark H3K56Ac in response to ultraviolet radiation (UVR)-induced DNA damage. Here
Wataru Sakai et al.
Scientific reports, 10(1), 19704-19704 (2020-11-14)
The ubiquitin-proteasome system (UPS) plays crucial roles in regulation of various biological processes, including DNA repair. In mammalian global genome nucleotide excision repair (GG-NER), activation of the DDB2-associated ubiquitin ligase upon UV-induced DNA damage is necessary for efficient recognition of
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service