Skip to Content
Merck
All Photos(1)

Key Documents

EHU159851

Sigma-Aldrich

MISSION® esiRNA

targeting human CD209

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTCCCCAGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTTAAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

D Feng et al.
Clinical and experimental immunology, 191(1), 107-115 (2017-09-13)
In the pathological process of acute kidney injury (AKI), innate immune receptors are essential in inflammatory response modulation; however, the precise molecular mechanisms are still unclear. Our study sought to demonstrate the inflammatory response mechanisms in renal tubular epithelial cells
Aiping Liu et al.
PloS one, 9(1), e85176-e85176 (2014-01-24)
Ex vivo foreskin models have demonstrated that inner foreskin is more susceptible to HIV-1 infection than outer foreskin. In the present study we characterized the compartition of HIV-1 target cells and quantified these cells in the epidermis and dermis of
Yanmei Jiang et al.
PloS one, 9(12), e114748-e114748 (2014-12-17)
Colon cancer has always been diagnosed at a late stage, which is associated with poor prognosis. The currently used serum tumor markers CEA and CA19-9 display low sensitivity and specificity and may not have diagnostic value in early stage colon
Jian Wu et al.
Frontiers in immunology, 9, 1847-1847 (2018-08-29)
By shaping T cell immunity, tolerogenic dendritic cells (tDCs) play critical roles in the induction of immune tolerance after transplantation. However, the role of long noncoding RNAs (lncRNAs) in the function and immune tolerance of dendritic cells (DCs) is largely
Zoltan Beck et al.
PloS one, 8(11), e81002-e81002 (2013-11-28)
Chronic HIV-1 infection is associated with persistent viremia in most patients, but it remains unclear how free virus may survive the potential hostile effects of plasma. We investigated whether sites might exist on the surfaces of circulating blood cells for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service