Skip to Content
Merck
All Photos(1)

Documents

EHU104701

Sigma-Aldrich

MISSION® esiRNA

targeting human CLIC4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAGAGGCTCTTCATGATTCTTTGGCTCAAAGGAGTTGTATTTAGTGTGACGACTGTTGACCTGAAAAGGAAGCCAGCAGACCTGCAGAACTTGGCTCCCGGGACCCACCCACCATTTATAACTTTCAACAGTGAAGTCAAAACGGATGTAAATAAGATTGAGGAATTTCTTGAAGAAGTCTTATGCCCTCCCAAGTACTTAAAGCTTTCACCAAAACACCCAGAATCAAATACTGCTGGAATGGACATCTTTGCCAAATTCTCTGCATATATCAAGAATTCAAGGCCAGAGGCTAATGAAGCACTGGAGAGGGGTCTCCTGAAAACCCTGCAGAAACTGGATGAATATCTGAATTCTCCTCTCCCTGATGAAATTGATGAAAATAGTATGGAGGACATAAAGTTTTCTACACGTAAATTTCTGGATGGCAATGAAATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiu-Yun Yu et al.
Journal of cellular biochemistry, 119(1), 659-668 (2017-06-22)
This study explored the effects involved in silencing CLIC4 on apoptosis and proliferation of mouse liver cancer Hca-F and Hca-P cells. A CLIC4-target small interfering RNA (siRNA) was designed to compound into two individual complementary oligonucleotide chains. A process of
Baolong Wang et al.
Carcinogenesis, 41(6), 841-849 (2019-09-29)
Chloride intracellular channel protein 4 (CLIC4) has been implicated in different types of cancers, but the role of CLIC4 in the development of gastric cancer (GC) remains unknown. We analyzed the expression of CLIC4 in 102 pairs of gastric adenocarcinomas
Wei Guo et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 9049-9057 (2015-06-19)
A recent study reported that miR-570 was the most important microRNA in the microRNA gene networks of alcoholic liver disease that has the potential of progressing to hepatocellular carcinoma. However, litter is known regarding the expression and specific function of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service