Skip to Content
Merck
All Photos(1)

Key Documents

EHU092651

Sigma-Aldrich

MISSION® esiRNA

targeting human ACACA (1)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGGGTGCGTTTCAATCAGATGCTTCTGGAACGTCGAAATTGTCTTCTTTGGAAAGAACCATCCCCTCTTTGGGCTTCAGAGGCCCAAATTGAGGCGCAATGATGAGAGGATGTGGTGGTCTACTCTGATGTCAATCTTGAGGGCTAGGTCTTTCTGGAAGTGGATATCTACTCAGACAGTAAGAATTATAAGAGCTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCAGCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bingyu Ye et al.
Molecular medicine reports, 19(5), 3431-3440 (2019-03-01)
Acetyl‑coenzyme A carboxylase 1 (ACC1) serves a major role in fatty acid synthesis. Previous reports have indicated that ACC1 is a promising drug target for treating human diseases, particularly cancers and metabolic diseases; however, the role of ACC1 in liver
Wenjuan Li et al.
Molecular carcinogenesis, 55(11), 1739-1746 (2015-10-17)
Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has
Maosong Ye et al.
Journal of thoracic disease, 8(8), 1943-1955 (2016-09-14)
Lung cancer is the leading cause of cancer-related death worldwide. Patients with lung cancer are very frequently present with pulmonary infections, in particular with Gram-negative bacteria. Herein, we investigated the effect of the co-presence of Gram-negative bacteria on outgrowth and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service