Skip to Content
Merck
All Photos(1)

Key Documents

EHU092501

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€194.00
50 μG
€343.00

€194.00


Check Cart for Availability


Select a Size

Change View
20 μG
€194.00
50 μG
€343.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€194.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liping Sun et al.
IUBMB life, 69(3), 170-178 (2017-02-12)
This study aims to investigate the effects of TNF receptors associated factor 3 (TRAF3) on the signaling pathway and expression of downstream products of nuclear factor kappa B (NF-κB) in the epithelial cells of renal ducts in individuals with polycystic
Peng Li et al.
Brain, behavior, and immunity, 79, 174-185 (2019-02-04)
Neuroinflammation occurs after germinal matrix hemorrhage (GMH) and induces secondary brain injury. Interferon-α (IFN-α) has been shown to exert anti-inflammatory effects in infectious diseases via activating IFNAR and its downstream signaling. We aimed to investigate the anti-inflammatory effects of Recombinant
Hongzhi Sun et al.
International immunopharmacology, 88, 106691-106691 (2020-08-22)
Acute pancreatitis (AP) is an inflammatory disease with high morbidity and mortality. Dysregulation of microRNAs (miRNAs) was involved in human diseases, including AP. However, the effects of miR-92b-3p on AP process and its mechanism remain not been fully clarified. The
Yan Zhou et al.
Cell death & disease, 12(1), 10-10 (2021-01-09)
Neuronal apoptosis has an important role in early brain injury (EBI) following subarachnoid hemorrhage (SAH). TRAF3 was reported as a promising therapeutic target for stroke management, which covered several neuronal apoptosis signaling cascades. Hence, the present study is aimed to
Jin Liu et al.
Scientific reports, 7, 40487-40487 (2017-01-11)
The role of osteoclastic miRNAs in regulating osteolytic bone metastasis (OBM) of breast cancer is still underexplored. Here, we examined the expression profiles of osteoclastogenic miRNAs in human bone specimens and identified that miR-214-3p was significantly upregulated in breast cancer

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service