Skip to Content
Merck
All Photos(1)

Key Documents

EHU088281

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€194.00
50 μG
€343.00

€194.00


Check Cart for Availability


Select a Size

Change View
20 μG
€194.00
50 μG
€343.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€194.00


Check Cart for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGAACTCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng He et al.
Journal of translational medicine, 17(1), 335-335 (2019-10-06)
The P38 mitogen-activated protein kinase (MAPK) pathway plays an essential role in CVB3-induced diseases. We previously demonstrated microRNA-21 has potential inhibitory effect on the MAP2K3 which locates upstream of P38 MAPK and was upregulated in mouse hearts upon CVB3 infection.
Jing Wang et al.
Cell transplantation, 29, 963689720938023-963689720938023 (2020-07-02)
Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease. New evidence suggested that linc02381 suppressed colorectal cancer progression by regulating PI3 K signaling pathway, but the role of linc02381 in other diseases, such as RA, remains unclear. This study aimed
Cheng-Fang Tsai et al.
Toxicology and applied pharmacology, 338, 182-190 (2017-11-29)
Connexins are widely supported as tumor suppressors due to their downregulation in cancers, nevertheless, more recent evidence suggests roles for connexins in facilitating tumor progression in later stages, including metastasis. One of the key factors regulating the expression, modification, stability
Chien-Hsing Lee et al.
Oncotarget, 8(29), 47425-47439 (2017-05-26)
Alpha-mangostin, a natural xanthonoid, has been reported to possess the anti-cancer property in various types of human cancer. However, its effects and mechanism of α-mangostin in cervical cancer remain unclear. We found that α-mangostin effectively inhibited cell viability, resulted in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service