Skip to Content
Merck
All Photos(1)

Key Documents

EHU038621

Sigma-Aldrich

MISSION® esiRNA

targeting human B2M

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€194.00
50 μG
€343.00

€194.00


Check Cart for Availability


Select a Size

Change View
20 μG
€194.00
50 μG
€343.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€194.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... B2M(567) , B2M(567)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Egle-Helene Ervin et al.
Stem cell research & therapy, 10(1), 43-43 (2019-01-27)
Human embryonic stem (hES) cells serve as an invaluable tool for research and future medicine, but their transfection often leads to unwanted side effects as the method itself may induce differentiation. On the other hand, RNA interference (RNAi)-based targeted gene
Zaruhi Karabekian et al.
Biomedical materials (Bristol, England), 10(3), 034101-034101 (2015-03-17)
The presence of non-autologous major histocompatibility complex class I (MHC-I) molecules on the surface of the grafted cells is one of the main reasons for their rejection in non-syngeneic hosts. We present a straightforward strategy to decrease the presence of
Matthew E Agwae et al.
Molecular biology reports, 47(5), 3987-3992 (2020-04-03)
iRhom2 is an inactive rhomboid protease involved in diverse signalling events. It has been implicated in the pathogenesis of a number of cancer types, including oesophageal and ovarian cancer, while its closely associated family member, iRhom1, is implicated in head
Marlieke L M Jongsma et al.
Immunity, 54(1), 132-150 (2020-12-04)
HLA class I (HLA-I) glycoproteins drive immune responses by presenting antigens to cognate CD8+ T cells. This process is often hijacked by tumors and pathogens for immune evasion. Because options for restoring HLA-I antigen presentation are limited, we aimed to identify

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service