Skip to Content
Merck
All Photos(1)

Key Documents

EHU023041

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0C, RP11-20I23.1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAGCTGGGCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGACGCTGGCGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAGGTGCTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGAATATTATGTAAAGACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCCCCCAGTAGTTGGTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGCCCGCCCCGTGCCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAGTGCTCTGTGTATGCGGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicholas J Barrows et al.
Scientific reports, 9(1), 9711-9711 (2019-07-06)
Hundreds of cellular host factors are required to support dengue virus infection, but their identity and roles are incompletely characterized. Here, we identify human host dependency factors required for efficient dengue virus-2 (DENV2) infection of human cells. We focused on
Yuji Tani et al.
Scientific reports, 5, 10878-10878 (2015-06-04)
(Pro)renin receptor (PRR) has a single transmembrane domain that co-purifies with the vacuolar H(+)-ATPase (V-ATPase). In addition to its role in cellular acidification, V-ATPase has been implicated in membrane fusion and exocytosis via its Vo domain. Results from the present
Manuela Salerno et al.
PloS one, 9(10), e110340-e110340 (2014-10-21)
Rhabdomyosarcoma is the most frequent soft tissue sarcoma in children and adolescents, with a high rate of relapse that dramatically affects the clinical outcome. Multiagent chemotherapy, in combination with surgery and/or radiation therapy, is the treatment of choice. However, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service