Skip to Content
Merck
All Photos(1)

Key Documents

EHU007711

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC30A10

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€194.00
50 μG
€343.00

€194.00


Check Cart for Availability


Select a Size

Change View
20 μG
€194.00
50 μG
€343.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€194.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTCCCAAAAGGAGTCAACATGGAAGAGCTGATGAGTAAACTCTCTGCTGTGCCTGGAATTAGCAGTGTACATGAAGTGCACATCTGGGAACTTGTAAGTGGAAAGATTATTGCCACCCTGCACATCAAGTATCCTAAGGACAGGGGATATCAAGATGCCAGCACAAAAATTCGAGAAATCTTCCACCATGCGGGAATCCACAATGTGACCATCCAGTTTGAAAATGTGGACTTGAAGGAACCCCTGGAGCAGAAGGACTTACTGTTGCTCTGCAACTCACCCTGCATCTCCAAGGGCTGTGCTAAGCAGCTGTGTTGTCCCCCCGGGGCACTGCCTCTGGCTCACGTCAATGGCTGTGCTGAGCACAATGGTGGGCCCTCTCTAGACACATACGGAAGTGATGGCCTCAGTAGAAGAGACGCAAGAGAAGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Hou et al.
European review for medical and pharmacological sciences, 24(12), 6682-6691 (2020-07-08)
Colorectal cancer is a common malignancy and a common cause of tumor-related death. Long non-coding RNAs (lncRNAs) have become an important regulatory factor and tissue specific biomarker for a variety of cancers, including colorectal cancer. Recent evidence indicates that the
Dinorah Leyva-Illades et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(42), 14079-14095 (2014-10-17)
Manganese (Mn) is an essential metal, but elevated cellular levels are toxic and may lead to the development of an irreversible parkinsonian-like syndrome that has no treatment. Mn-induced parkinsonism generally occurs as a result of exposure to elevated Mn levels

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service