Skip to Content
Merck
All Photos(1)

Key Documents

EHU003621

Sigma-Aldrich

MISSION® esiRNA

targeting human WEE1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€194.00
50 μG
€343.00

€194.00


Estimated to ship on30 April 2025



Select a Size

Change View
20 μG
€194.00
50 μG
€343.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€194.00


Estimated to ship on30 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATACAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nupam P Mahajan et al.
Oncotarget, 8(63), 106352-106368 (2018-01-02)
Epigenetic signaling networks dynamically regulate gene expression to maintain cellular homeostasis. Previously, we uncovered that WEE1 phosphorylates histone H2B at tyrosine 37 (pY37-H2B) to negatively regulate global histone transcriptional output. Although pY37-H2B is readily detected in cancer cells, its functional
Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service