HMI1662

MISSION^® microRNA Mimic

hsa-miR-4664-3p

• UNSPSC-Code: 12352200
• miRNA ID: hsa-miR-4664-3p Sanger Database

Eigenschaften

• Produktlinie: MISSION^®
• Form: solid
• Ausgereifte Sequenz: CUUCCGGUCUGUGAGCCCCGUC
• Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen: MIMAT0019738
• Sanger microRNA-Hinterlegungsnummer: MI0017294
• Lagertemp.: −20°C
• Angaben zum Gen: human ... hsa-miR-4664-3p(100616318)

Beschreibung

Allgemeine Beschreibung

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

• Optimized and ready for transfection.
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
• Available as a whole human library and individual miRNA targets.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sicherheitshinweise

• Lagerklassenschlüssel: 13 - Non Combustible Solids
• WGK: WGK 3
• Flammpunkt (°F): Not applicable
• Flammpunkt (°C): Not applicable