Direkt zum Inhalt
Merck

EMU196641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkcc

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCACTCCACCTTTCAGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCAACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCAAGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCACCCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTTGGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTCAAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGGGTTCCTGAC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Leider sind derzeit keine COAs für dieses Produkt online verfügbar.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sergio Carracedo et al.
BMC developmental biology, 13, 16-16 (2013-05-04)
Protein kinase C epsilon (PKCϵ) belongs to the novel PKC subfamily, which consists of diacylglycerol dependent- and calcium independent-PKCs. Previous studies have shown that PKCϵ is important in different contexts, such as wound healing or cancer. In this study, we
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of
Sergio Carracedo et al.
BMC developmental biology, 13, 2-2 (2013-01-12)
The members of the protein kinase C (PKC) family consist of serine/threonine kinases classified according to their regulatory domain. Those that belong to the novel PKC subfamily, such as PKCδ, are dependent on diacylglycerol but not Calcium when considering their
Imene Jaadane et al.
Journal of cellular and molecular medicine, 19(7), 1646-1655 (2015-03-18)
Light-induced retinal degeneration is characterized by photoreceptor cell death. Many studies showed that photoreceptor demise is caspase-independent. In our laboratory we showed that leucocyte elastase inhibitor/LEI-derived DNase II (LEI/L-DNase II), a caspase-independent apoptotic pathway, is responsible for photoreceptor death. In
W Miklos et al.
Cancer letters, 361(1), 112-120 (2015-03-10)
Although triapine is promising for treatment of advanced leukemia, it failed against solid tumors due to widely unknown reasons. To address this issue, a new triapine-resistant cell line (SW480/tria) was generated by drug selection and investigated in this study. Notably

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.