Direkt zum Inhalt
Merck

EMU088941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGGACAATGGACTGGTTGAGCCCATCTCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAGGCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGGGACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATTGCA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Laijun Lai et al.
PloS one, 8(12), e82998-e82998 (2013-12-19)
T cell immunodeficiency is a major complication of bone marrow (BM) transplantation (BMT). Therefore, approaches to enhance T cell reconstitution after BMT are required. We have purified a hybrid cytokine, consisting of IL-7 and the β-chain of hepatocyte growth factor
David Chiron et al.
Oncotarget, 6(11), 8750-8759 (2015-03-24)
The aggressive biological behavior of mantle cell lymphoma (MCL) and its short response to current treatment highlight a great need for better rational therapy. Herein, we investigate the ability of ABT-199, the Bcl-2-selective BH3 mimetic, to kill MCL cells. Among
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
S Marina Casalino-Matsuda et al.
Journal of immunology (Baltimore, Md. : 1950), 194(11), 5388-5396 (2015-04-22)
Hypercapnia, the elevation of CO2 in blood and tissue, commonly develops in patients with advanced lung disease and severe pulmonary infections, and it is associated with high mortality. We previously reported that hypercapnia alters expression of host defense genes, inhibits
Yoko Hari et al.
Oncotarget, 6(39), 41902-41915 (2015-10-28)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various types of cancer cells without damaging normal cells. However, in terms of pancreatic cancer, not all cancer cells are sensitive to TRAIL. In this study, we examined a panel

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.