Direkt zum Inhalt
Merck

EMU075291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myc

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTCTCCACTCACCAGCACAACTACGCCGCACCCCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAGCAGATCAGCAACAACCGCAAGTGCTCCAGCCCCAGGTCCTCAGACACGGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGGAACGAGCTGAAGCGCAGCTTTTTTGCCCTGCGTGACCAGATCCCTGAATTGGAAAACAACGAAAAGGCCCCCAAGGTAGTGATCCTCAAAAAAGCCACCGCCTACATCCTGTCCATTCAAGCAGACGAGCACAAGCTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAAACTGACCTAACTCGAGGAGGAGCTGGA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Naveen K Tangudu et al.
Molecular cancer therapeutics, 14(5), 1259-1269 (2015-02-20)
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge
Wen-Li Mu et al.
Stem cells (Dayton, Ohio), 33(7), 2135-2147 (2015-05-06)
Mouse somatic cells can be reprogrammed into induced pluripotent stem cells by defined factors known to regulate pluripotency, including Oct4, Sox2, Klf4, and c-Myc. Together with Oct4, Sox2 plays a major role as a master endogenous pluripotent genes trigger in
C M Lucas et al.
Leukemia, 29(7), 1514-1523 (2015-03-15)
High cancerous inhibitor of PP2A (CIP2A) protein levels at diagnosis of chronic myeloid leukaemia (CML) are predictive of disease progression in imatinib-treated patients. It is not known whether this is true in patients treated with second generation tyrosine kinase inhibitors
Kazunori Hamamura et al.
Cellular signalling, 26(11), 2358-2369 (2014-07-20)
Wnt signaling plays a major role in bone homeostasis and mechanotransduction, but its role and regulatory mechanism in osteoclast development are not fully understood. Through genome-wide in silico analysis, we examined Wnt3a-driven regulation of osteoclast development. Mouse bone marrow-derived cells
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.