Direkt zum Inhalt
Merck

EMU021961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk14

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGAGTGGAAGAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAAATGGAGTCCTGAGCACCTGGTTTCTGTTCTGTCTATCTCACTTCACTGTGAGGGGAAGACCTTCTCATGGGAACTCTCCAAATACCATTCAAGTGCCTCTTGTTGAAAGATTCCTTCATGGTGGAAGGGGGTGCATGTATGTGTTAGTGTTTGTGTGTGTGTGTGTGTCTGTCTGTTCGTCTGTCCACCTATCTTTGTGGAAGTCACTGTGATGGTAGTGACTTTATGAGTTGTGAATGGTCCTTGGCAGTCTGCCTGCTTTCTCAGAGTCTGGGCAGGCCGATGGGAACTGTCATCTCCTTAGGGATGTGTGTGTTCAGTGCAAAGTAAGAAATATGAAAATATCCCTGTTCTTAGTTACCTTGCCACTTTGGCTTC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hye Jeong Lee et al.
Molecular endocrinology (Baltimore, Md.), 29(6), 873-881 (2015-04-01)
Irisin is a novel myokine produced by skeletal muscle. However, its metabolic role is poorly understood. In the present study, irisin induced glucose uptake in differentiated skeletal muscle cells. It increased AMP-activated protein kinase (AMPK) phosphorylation and the inhibition of
Ana M Tormos et al.
PloS one, 12(2), e0171738-e0171738 (2017-02-07)
Hepatocyte poliploidization is an age-dependent process, being cytokinesis failure the main mechanism of polyploid hepatocyte formation. Our aim was to study the role of p38α MAPK in the regulation of actin cytoskeleton and cytokinesis in hepatocytes during development and aging.
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.