Direkt zum Inhalt
Merck

EMU021801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcr4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCTGCCCACCATCTACTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACCAACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTGGGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTTGCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Dong-Hua Luo et al.
Journal of translational medicine, 11, 203-203 (2013-08-31)
Recent studies have indicated that the expression of endothelin A receptor (ETAR) and chemokine receptor 4 (CXCR4) could be used as an indicator of the metastatic potential of nasopharyngeal carcinoma (NPC). The aim of this study was to determine the
Yan Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 21(11), 1310-1317 (2014-08-31)
C-X-C chemokine receptor type 4 (CXCR4) signaling has been demonstrated to be involved in cancer invasion and migration; therefore, CXCR4 antagonist can serve as an anti-cancer drug by preventing tumor metastasis. This study aimed to identify the CXCR4 antagonists that
Shijie Ma et al.
International journal of clinical oncology, 20(3), 525-530 (2014-08-26)
CXCR4 and glycogen synthase kinase-3β (GSK3β) promote proliferation and invasion of pancreatic cancer. Inhibition of CXCR4 suppresses GSK3β expression. However, the molecular mechanism by which CXCR4 contributes to human pancreatic cancer metastasis is not completely understood. In this study, therefore
Yingzhuan Zhan et al.
Journal of cellular and molecular medicine, 19(7), 1614-1623 (2015-03-11)
The increased migration and invasion of breast carcinoma cells are key events in the development of metastasis to the lymph nodes and distant organs. CXCR4, the receptor for stromal-derived factor-1, is reportedly involved in breast carcinogenesis and invasion. In this

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.