Direkt zum Inhalt
Merck

EMU014681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ezh2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGTTCAGAGGGAGCAAAGCTTGCATTCATTTCATACGCTCTTCTGTCGACGATGTTTTAAGTATGACTGCTTCCTACATCCCTTCCATGCAACACCCAACACATATAAGAGGAAGAACACAGAAACAGCTTTGGACAACAAGCCTTGTGGACCACAGTGTTACCAGCATCTGGAGGGAGCTAAGGAGTTTGCTGCTGCTCTTACTGCTGAGCGTATAAAGACACCACCTAAACGCCCAGGGGGGCGCAGAAGAGGAAGACTTCCGAATAACAGTAGCAGACCCAGCACCCCCACCATCAGTGTGCTGGAGTCAAAGGATACAGACAGTGACAGAGAAGCAGGGACTGAAACTGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAAAAAGATGAGACGTCCAGCTCCTCTGAAGCAAATTCTCGG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

B C Roy et al.
Oncogene, 34(34), 4519-4530 (2014-12-09)
The enhancer of zeste homolog-2 (EZH2) represses gene transcription through histone H3 lysine-27-trimethylation (H3K27me3). Citrobacter rodentium (CR) promotes crypt hyperplasia and tumorigenesis by aberrantly regulating Wnt/β-catenin signaling. We aimed at investigating EZH2's role in epigenetically regulating Wnt/β-catenin signaling following bacterial
Lu Lu et al.
Toxicology and applied pharmacology, 289(2), 276-285 (2015-09-30)
Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Ying Qi et al.
Molecular bioSystems, 11(7), 1980-1986 (2015-05-08)
A histone methyltransferase enhancer of zeste homologue 2 (EZH2) catalyzes trimethylation at histone H3 lysine27 (H3K27me3) and is frequently dysregulated in a wide range of human cancers. EZH2-mediated gene silencing contributes to carcinogenesis and regulates stem cell maintenance and differentiation;
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.