Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU010551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Spp1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCTGATGAGACCGTCACTGCTAGTACACAAGCAGACACTTTCACTCCAATCGTCCCTACAGTCGATGTCCCCAACGGCCGAGGTGATAGCTTGGCTTATGGACTGAGGTCAAAGTCTAGGAGTTTCCAGGTTTCTGATGAACAGTATCCTGATGCCACAGATGAGGACCTCACCTCTCACATGAAGAGCGGTGAGTCTAAGGAGTCCCTCGATGTCATCCCTGTTGCCCAGCTTCTGAGCATGCCCTCTGATCAGGACAACAACGGAAAGGGCAGCCATGAGTCAAGTCAGCTGGATGAACCAAGTCTGGAAACACACAGACTTGAGCATTCCAAAGAGAGCCAGGAGAGTGCCGATCAGTCGGATGTGATCGATAGTCAAGCAAGTTCCAAAGCCAGCCTGGAACATCAGAGCCACAA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000029304

NCBI-Hinterlegungsnummer

NP_033289

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... SPP1(20750) , Spp1(20750)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Karl Blirando et al.
Digestive diseases and sciences, 60(6), 1633-1644 (2015-01-13)
Radiation damage to the normal gut is a dose-limiting factor in the application of radiation therapy to treat abdominal and pelvic cancers. All tissue cell types react in concert to orchestrate an acute inflammatory reaction followed by a delayed chronic
Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.