Direkt zum Inhalt
Merck

EMU003641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp6ap2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum12. April 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum12. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTCTTTCTCTCCGAACTGCAAGTGCTACATGATATTTCCAGTTTGTTGTCTCGTCATAAGCATCTAGCCAAGGACCATTCACCCGACTTGTATTCATTGGAGCTGGCAGGTTTGGATGAACTTGGGAAGCGTTATGGGGAAGACTCTGAACAGTTCAGGGATGCTTCTAAGATCCTTGTTGATGCTCTCCAAAAGTTTGCAGATGACATGTACAGTCTCTATGGTGGGAACGCAGTGGTAGAGTTAGTGACTGTCAAATCATTCGACACATCCCTTGTGAGGAAGTCAAGGACCATCCTTGAGGCAAAACAAGAGAACACCCAAAGTCCTTATAACCTTGCATATAAGTATAATTTGGAGTATTCAGTGGTTTTCAACTTGGTACTGTGGATTATGATCGGCTTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Wendy W Batenburg et al.
PloS one, 9(6), e100954-e100954 (2014-06-27)
Dysfunction of renin-angiotensin system (RAS) contributes to the pathogenesis of diabetic retinopathy (DR). Prorenin, the precursor of renin is highly elevated in ocular fluid of diabetic patients with proliferative retinopathy. Prorenin may exert local effects in the eye by binding
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.