Direkt zum Inhalt
Merck

EHU157031

Sigma-Aldrich

MISSION® esiRNA

targeting human NES

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGAGGCAGAGCTGAATCTGAGGGAGCAGGATGGCTTCACTGGGAAGGAGGAGGTGGTAGAGCAGGGAGAGCTGAATGCCACAGAGGAGGTCTGGATCCCAGGCGAGGGGCACCCAGAGAGCCCTGAGCCCAAAGAGCAGAGAGGCCTGGTTGAGGGAGCCAGTGTGAAGGGAGGGGCTGAGGGCCTCCAGGACCCTGAAGGGCAATCACAACAGGTGGGGGCCCCAGGCCTCCAGGCTCCCCAGGGGCTGCCAGAGGCGATAGAGCCCCTGGTGGAAGATGATGTGGCCCCAGGGGGTGACCAAGCCTCCCCAGAGGTCATGTTGGGGTCAGAGCCTGCCATGGGTGAGTCTGCTGCGGGAGCTGAGCCAGGCCCGGGGCAGGGGGTGGGAGGGCTGGGGGACCCAGGCCATCTGACCAGGGAAGAGGTGATGGAACCACCCCTGGAAGAGGAGAGTTTGGAGGCAAAGAGGGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xu Yang et al.
Kidney & blood pressure research, 43(2), 616-627 (2018-04-25)
Preeclampsia (PE) is a pregnancy-specific hypertensive disorder that is characterised by a high incidence of hypertension and proteinuria. Podocytes are involved in the formation of a split membrane, which is the last barrier preventing the leakage of protein into the
Yasuhiro Shinkai et al.
Nucleic acid therapeutics, 27(3), 168-175 (2017-03-30)
Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Kim Tardif et al.
American journal of physiology. Heart and circulatory physiology, 308(10), H1265-H1274 (2015-03-15)
Proliferation and hypertrophy of vascular smooth muscle cells represent hallmark features of vessel remodeling secondary to hypertension. The intermediate filament protein nestin was recently identified in vascular smooth muscle cells and in other cell types directly participated in proliferation. The

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.