Direkt zum Inhalt
Merck

EHU156661

Sigma-Aldrich

MISSION® esiRNA

targeting human NFE2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AATGCTCCAAGTGAGCCATCATTTGAGCCCCAAGCCCCAGCTCCATACCTTGGACCTCCACCACCCACAACTTACTGCCCCTGCTCAATCCACCCAGATTCTGGCTTCCCACTTCCTCCACCACCTTATGAGCTCCCAGCATCCACATCCCATGTCCCAGATCCCCCATACTCCTATGGCAACATGGCCATACCAGTCTCCAAGCCACTGAGCCTCTCAGGCCTGCTCAGTGAGCCGCTCCAAGACCCCTTAGCCCTCCTGGACATTGGGCTGCCAGCAGGGCCACCTAAGCCCCAAGAAGACCCAGAATCCGACTCAGGATTATCCCTCAACTATAGCGATGCTGAATCTCTTGAGCTGGAGGGGACAGAGGCTGGTCGGCGGCGCAGCGAATATGTAGAGATGTACCCAGTGGAGTACCCCTACTCACTCATGCCCAACTCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shunying Jin et al.
Life sciences, 254, 117783-117783 (2020-05-16)
This study aimed to examine the anti-fibrotic role of Nuclear Factor-Erythroid derived 2 (NF-E2) in human renal tubule (HK-11) cells and in type 1 and type 2 diabetic (T1D, T2D) mouse kidneys. Anti-fibrotic effects of NF-E2 were examined in transforming
Zhe Sha et al.
The Journal of cell biology, 217(5), 1757-1776 (2018-03-15)
Proteasome inhibitors are used as research tools and to treat multiple myeloma, and proteasome activity is diminished in several neurodegenerative diseases. We therefore studied how cells compensate for proteasome inhibition. In 4 h, proteasome inhibitor treatment caused dramatic and selective
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.