Direkt zum Inhalt
Merck

EHU155311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTCH1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTCGCCAGAAGATTGGAGAAGAGGCTATGTTTAATCCTCAACTCATGATACAGACCCCTAAAGAAGAAGGTGCTAATGTCCTGACCACAGAAGCGCTCCTACAACACCTGGACTCGGCACTCCAGGCCAGCCGTGTCCATGTATACATGTACAACAGGCAGTGGAAATTGGAACATTTGTGTTACAAATCAGGAGAGCTTATCACAGAAACAGGTTACATGGATCAGATAATAGAATATCTTTACCCTTGTTTGATTATTACACCTTTGGACTGCTTCTGGGAAGGGGCGAAATTACAGTCTGGGACAGCATACCTCCTAGGTAAACCTCCTTTGCGGTGGACAAACTTCGACCCTTTGGAATTCCTGGAAGAGTTAAAGAAAATAAACTATCAAGTGGACAGCTGGGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yingying Hong et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(7), 1413-1428 (2016-02-19)
Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterized by bone and skin abnormalities and a predisposition to various tumors. Keratocystic odontogenic tumors (KCOTs), which are common tumors of the jaw that cause extensive damage to the
Xuechao Wan et al.
Oncotarget, 9(4), 4798-4813 (2018-02-13)
Metastasis is the most common cause of mortality for non-small cell lung cancer (NSCLC). PTCH1, a receptor of Hedgehog (Hh) pathway, is reported to suppress cell proliferation. Interestingly, our previous study showed PTCH1 silencing promoted cell proliferation but inhibited cell
A Tam et al.
Scientific reports, 9(1), 3353-3353 (2019-03-06)
Genome-wide association studies have linked gene variants of the receptor patched homolog 1 (PTCH1) with chronic obstructive pulmonary disease (COPD). However, its biological role in the disease is unclear. Our objective was to determine the expression pattern and biological role
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.