Direkt zum Inhalt
Merck

EHU148811

Sigma-Aldrich

MISSION® esiRNA

targeting human SMN1, SMN2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hirotake Ichise et al.
PloS one, 11(3), e0150521-e0150521 (2016-03-08)
Phospholipase Cγ2 (PLCγ2)-deficient mice exhibit misconnections of blood and lymphatic vessels, and male infertility. However, the cell type responsible for vascular partitioning and the mechanism for male infertility remain unknown. Accordingly, we generated a mouse line that conditionally expresses endogenous
Thomas Koed Doktor et al.
Nucleic acids research, 45(1), 395-416 (2016-08-26)
Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes.
Adriana Roithová et al.
Nucleic acids research, 48(11), 6184-6197 (2020-05-07)
Spliceosomal small nuclear ribonucleoprotein particles (snRNPs) undergo a complex maturation pathway containing multiple steps in the nucleus and in the cytoplasm. snRNP biogenesis is strictly proofread and several quality control checkpoints are placed along the pathway. Here, we analyzed the
Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.