Direkt zum Inhalt
Merck

EHU143141

Sigma-Aldrich

MISSION® esiRNA

targeting human SPINT2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCTCAAGAAATGTGCCACTGTCACAGAGAATGCCACGGGTGACCTGGCCACCAGCAGGAATGCAGCGGATTCCTCTGTCCCAAGTGCTCCCAGAAGGCAGGATTCTGAAGACCACTCCAGCGATATGTTCAACTATGAAGAATACTGCACCGCCAACGCAGTCACTGGGCCTTGCCGTGCATCCTTCCCACGCTGGTACTTTGACGTGGAGAGGAACTCCTGCAATAACTTCATCTATGGAGGCTGCCGGGGCAATAAGAACAGCTACCGCTCTGAGGAGGCCTGCATGCTCCGCTGCTTCCGCCAGCAGGAGAATCCTCCCCTGCCCCTTGGCTCAAAGGTGGTGGTTCTGGCGGGGCTGTTCGTGATGGTGTTGATCCTCTTCCTGGGAGCCTCCATGGTCTACCTGATCCGGGTGGCACGGAGGAACCAGGAGCGTGCCCTGCGCACCGTCTGGAGCTCCGGAGATGACAAGGAGCAGCTGGTGAAGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Fernanda Marconi Roversi et al.
Journal of cellular and molecular medicine, 23(2), 1562-1571 (2018-11-30)
The role of tumour microenvironment in neoplasm initiation and malignant evolution has been increasingly recognized. However, the bone marrow mesenchymal stromal cell (BMMSC) contribution to disease progression remains poorly explored. We previously reported that the expression of serine protease inhibitor
Soonyean Hwang et al.
The Journal of investigative dermatology, 135(9), 2283-2291 (2015-04-25)
Aberrant HGF-MET (hepatocyte growth factor-met proto-oncogene) signaling activation via interactions with surrounding stromal cells in tumor microenvironment has significant roles in malignant tumor progression. However, extracellular proteolytic regulation of HGF activation, which is influenced by the tumor microenvironment, and its
Chuan-Jin Wu et al.
The Journal of clinical investigation, 127(2), 623-634 (2017-01-18)
Congenital tufting enteropathy (CTE) is a severe autosomal recessive human diarrheal disorder with characteristic intestinal epithelial dysplasia. CTE can be caused by mutations in genes encoding EpCAM, a putative adhesion molecule, and HAI-2, a cell surface protease inhibitor. A similar
Chuan-Jin Wu et al.
Cells, 9(4) (2020-04-25)
The homologs EpCAM and TROP2, which both interact with claudin-1 and claudin-7, are frequently coexpressed in epithelia including skin. Intestine uniquely expresses high levels of EpCAM but not TROP2. We previously identified EpCAM as a substrate of the membrane-anchored protease

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.