Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU093011

Sigma-Aldrich

MISSION® esiRNA

targeting human TPX2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCACCAAAGAAGATGAGGAAGAGGACGAACCGGTAGTGATAAAAGCTCAACCTGTGCCACATTATGGGGTGCCTTTTAAGCCCCAAATCCCAGAGGCAAGAACTGTGGAAATATGCCCTTTCTCGTTTGATTCTCGAGACAAAGAACGTCAGTTACAGAAGGAGAAGAAAATAAAAGAACTGCAGAAAGGGGAGGTGCCCAAGTTCAAGGCACTTCCCTTGCCTCATTTTGACACCATTAACCTGCCAGAGAAGAAGGTAAAGAATGTGACCCAGATTGAACCTTTCTGCTTGGAGACTGACAGAAGAGGTGCTCTGAAGGCACAGACTTGGAAGCACCAGCTGGAAGAAGAACTGAGACAGCAGAAAGAAGCAGCTTGTTTCAAGGCTCGTCCAAACACCGTCATCTCTCAGGAGCCCTTTG

Ensembl | Human Hinterlegungsnummer

ENSG00000088325

NCBI-Hinterlegungsnummer

NM_012112

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TPX2(22974) , TPX2(22974)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast
Helen Chen et al.
Cell cycle (Georgetown, Tex.), 13(14), 2248-2261 (2014-05-31)
Construction of a mitotic spindle requires biochemical pathways to assemble spindle microtubules and structural proteins to organize these microtubules into a bipolar array. Through a complex with dynein, the receptor for hyaluronan-mediated motility (RHAMM) cross-links mitotic microtubules to provide structural
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.