Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU089751

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGC

Ensembl | Human Hinterlegungsnummer

ENSG00000124813

NCBI-Hinterlegungsnummer

NM_004348

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... RUNX2(860) , RUNX2(860)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rajnee Kanwal et al.
Cancer letters, 430, 25-33 (2018-05-19)
The role of CD133 (Prominin-1) as a cancer stem cell marker may be useful for therapeutic approaches and prognostication in prostate cancer patients. We investigated the stem-cell-related function and biological features of a subpopulation of CD133+ cells isolated from established primary
Mingkun Han et al.
OncoTargets and therapy, 11, 6305-6316 (2018-10-16)
It was previously reported that downregulation of miR-218 promoted thyroid cancer cell invasion, migration, and proliferation. However, the biological functions of miR-218 and its possible regulatory mechanisms in papillary thyroid cancer (PTC) cells are still elusive. The expression levels of
Chen-Ling Zhang et al.
Biochemical and biophysical research communications, 482(4), 1469-1476 (2016-12-15)
Deregulation of epigenetic modification by microRNAs (miRNAs) contributes to the development of estrogen deficiency, a hallmark of the multigenic endocrine disorder polycystic ovary syndrome (PCOS), but its etiology remains unclear. Previous study has pointed to a tight association between miR-320a
Uwe Raaz et al.
Circulation research, 117(6), 513-524 (2015-07-26)
Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date. The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target
Masahiro Lee et al.
Biological trace element research, 178(2), 283-291 (2017-01-14)
Bone remodeling is a vital physiological process of healthy bone tissue in humans. Imbalances in this vital process lead to pathological conditions, including periodontal diseases. In this study, we characterized the effects of micromolar levels of NaF on the proliferation
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.