Direkt zum Inhalt
Merck

EHU088931

Sigma-Aldrich

MISSION® esiRNA

targeting human MSN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTCTTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGCGCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGCTGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCTGGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGACCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCTGTCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

WGK

WGK 1

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Bernard Degryse et al.
The international journal of biochemistry & cell biology, 88, 14-22 (2017-05-06)
The glycosyl-phosphatidyl-inositol (GPI)-anchored urokinase receptor (uPAR) has no intracellular domain, but nevertheless initiates signalling through proximal interactions with other membrane receptors including integrins. The relationships between uPAR and ezrin/radixin/moesin (ERM) proteins, moesin and merlin have never been explored. Moesin and
Shubing Lan et al.
Biochemical and biophysical research communications, 524(4), 861-868 (2020-02-15)
Moesin has been proved to be implicated in invasiveness and metastasis in many other cancers, but unclear in HCC. Thus, this study was performed to investigate the clinical significance of moesin and its biological functions in HCC. The results showed
Yutaro Hoshi et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1533-1545 (2019-08-15)
The purpose of this study was to clarify the roles of ERM proteins (ezrin/radixin/moesin) in the regulation of membrane localization and transport activity of transporters at the human blood-brain barrier (BBB). Ezrin or moesin knockdown in a human in vitro BBB
Yao-yin Li et al.
Oral oncology, 51(10), 935-943 (2015-07-22)
The present study aimed to clarify the role of Moesin in oral squamous cell carcinoma (OSCC) progression, especially in regulation of cell motility. Immunohistochemistry and western blotting were used to investigate the expression of Moesin, E-cadherin, p120-catenin and MT1-MMP in
Liza Botros et al.
Journal of cell science, 133(9) (2020-03-22)
Endothelial barrier dysfunction leads to edema and vascular leak, causing high morbidity and mortality. Previously, Abl kinase inhibition has been shown to protect against vascular leak. Using the distinct inhibitory profiles of clinically available Abl kinase inhibitors, we aimed to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.