Direkt zum Inhalt
Merck

EHU082601

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC10

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.