Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU081951

Sigma-Aldrich

MISSION® esiRNA

targeting human WISP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAACTAGGCAGGCACAAATCTTGGGTCTTGGGGACTAACCCAATGCCTGTGAAGCAGTCAGCCCTTATGGCCAATAACTTTTCACCAATGAGCCTTAGTTACCCTGATCTGGACCCTTGGCCTCCATTTCTGTCTCTAACCATTCAAATGACGCCTGATGGTGCTGCTCAGGCCCATGCTATGAGTTTTCTCCTTGATATCATTCAGCATCTACTCTAAAGAAAAATGCCTGTCTCTAGCTGTTCTGGACTACACCCAAGCCTGATCCAGCCTTTCCAAGTCACTAGAAGTCCTGCTGGATCTTGCCTAAATCCCAAGAAATGGAATCAGGTAGACTTTTAATATCACTAATTTCTTCTTTAGATGCCAAACCACAAGACTCTTTGGGTCCATTCAGATGAA

Ensembl | Human Hinterlegungsnummer

ENSG00000104415

NCBI-Hinterlegungsnummer

NM_080838

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... WISP1(8840) , WISP1(8840)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Eun Kyung Jung et al.
Oncology letters, 14(2), 1719-1724 (2017-08-10)
WNT1-inducible-signaling pathway protein-1 (WISP-1) belongs to the family of cysteine rich 61/connective tissue growth factor/nephroblastoma overexpressed matricellular proteins, which are involved in various biological processes, including cell adhesion, proliferation, differentiation, angiogenesis and carcinogenesis. In the present study, the expression of
Bo Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14507-14520 (2020-09-09)
Fibrosis is a pathological feature of chronic kidney disease and its progression correlates with declining renal function. Kidney fibrosis is driven by multiple profibrotic factors. This project examined the regulatory function of WNT1-inducible-signaling pathway protein 1 (WISP1) in the development
Mitsuaki Ono et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(1), 193-208 (2010-08-05)
Wnt-induced secreted protein 1 (WISP-1/CCN4) is a member of the CCN family that is highly expressed in skeletal tissue and in osteoprogenitor cells induced to differentiate in vitro. To determine the function of WISP-1 during osteogeneis, osteogenic bone marrow stromal
Jing-Yuan Chuang et al.
PloS one, 8(10), e78022-e78022 (2013-11-10)
Oral squamous cell carcinoma (OSCC) has a tendency to migrate and metastasize. WNT1-inducible signaling pathway protein 1 (WISP-1) is a cysteine-rich protein that belongs to the Cyr61, CTGF, Nov (CCN) family of matrix cellular proteins. The effect of WISP-1 on
Xiaomin Zhang et al.
International journal of clinical and experimental pathology, 8(11), 15489-15496 (2016-01-30)
WISP1, a Wnt-induced secreted protein, has been found to have anticancer activity. ALL is a leading cause of death. Here we investigate the WISP1 effects on ALL Jurkat cells. Cell viability was assessed by CCK-8. Cell cycle and apoptosis were
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.