Direkt zum Inhalt
Merck

EHU081321

Sigma-Aldrich

MISSION® esiRNA

targeting human BDNF

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yu-Pu Liu et al.
Frontiers in neuroscience, 14, 525144-525144 (2020-11-03)
Growing evidence indicates that electroacupuncture (EA) has a definite effect on the treatment of peripheral nerve injury (PNI), but its mechanism is not completely clear. MicroRNAs (miRNAs) are involved in the regulation of a variety of biological processes, and EA
L Gao et al.
Neoplasma, 65(1), 89-96 (2018-01-13)
Recent studies have confirmed the existence of BDNF and tropomyosin-related kinase B (TrkB) in normal and cancerous urothelium. However, the corresponding mechanisms and upstream signal pathways of BDNF/TrkB have not been fully discovered. This study aimed to investigate the effects
E Bouvier et al.
Molecular psychiatry, 22(12), 1701-1713 (2016-09-21)
Stressful life events produce a state of vulnerability to depression in some individuals. The mechanisms that contribute to vulnerability to depression remain poorly understood. A rat model of intense stress (social defeat (SD), first hit) produced vulnerability to depression in
Yiheng Wang et al.
Experimental brain research, 234(4), 1057-1065 (2015-12-29)
Local anesthetic may cause neurotoxicity in developing neurons. In this study, we examined the molecular mechanisms of microRNA-210 (miR-210) in regulating bupivacaine-induced dorsal root ganglia (DRG) neurotoxicity in vitro. Young mouse (P30) DRG explants were cultured in vitro and treated
Chun-Yan Sun et al.
Oncology reports, 37(5), 2751-2760 (2017-04-14)
Brain-derived neurotrophic factor (BDNF) is expressed in a number of neural and non-neuronal tumors. The present study investigated the effect of endogenous BDNF on the biological behavior of cervix cancer cells using small interfering RNA (siRNA). HeLa, a cervix cancer

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.