Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU079401

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGTTCAAGGGAAAGACGAGATCTTGCACAAGGCACTCTGCTTCTGCCCTTGGCTGGGGAAGGGTGGCATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACCCTCAGGAAGGTC

Ensembl | Human Hinterlegungsnummer

ENSG00000095970

NCBI-Hinterlegungsnummer

NM_018965

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TREM2(54209) , TREM2(54209)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiao-Yan Wang et al.
Biochemical and biophysical research communications, 532(3), 329-335 (2020-09-27)
Drug resistance remains the unresolved obstacle for gastric cancer (GC) treatment. Recently more and more studies have shown that microRNAs are involved in cancer resistance and could apply to drug resistance therapy in tumors. The relationship between miR-149 and 5-fluorouracil
Teng Jiang et al.
Neurobiology of aging, 36(12), 3176-3186 (2015-09-15)
Tau pathology is a pathological hallmark for several neurodegenerative diseases including Alzheimer's disease and frontotemporal dementia. As a novel susceptibility gene for these 2 diseases, triggering receptor expressed on myeloid cells 2 (TREM2) gene encodes an immune receptor that is
Saini Yi et al.
Cytotechnology, 72(4), 589-602 (2020-07-06)
Triggering receptor expressed on myeloid cells-2 (TREM2) is an innate immune receptor that promotes phagocytosis by microglia. However, whether TREM2 is related to the stimulus-dependent phagocytic activity of microglia is unclear. In this study, the primary cultured microglia were stimulated
Shengpan Chen et al.
Journal of neuroinflammation, 17(1), 168-168 (2020-05-30)
Neuroinflammation is an important host defense response to secondary brain injury after intracerebral hemorrhage (ICH). Triggering receptor expressed on myeloid cells 2 (TREM2) confers strong neuroprotective effects by attenuating neuroinflammation in experimental ischemic stroke. Recent studies suggest that apolipoprotein E
Rumana Akhter et al.
Molecular immunology, 131, 171-179 (2021-01-20)
Alzheimer's disease (AD) is characterized by the accumulation in the brain of extracellular amyloid β (Aβ) plaques as well as intraneuronal inclusions (neurofibrillary tangles) consisting of total tau and phosphorylated tau. Also present are dystrophic neurites, loss of synapses, neuronal

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.