Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU073721

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGGACAAGTGGGACAGATTCGTCAAGCGCATCTTCTACTTCAACTTCCTGGTCTACTGCCTGTACATGATCATCTTCACCATGGCTGCCTACTACAGGCCCGTGGATGGCTTGCCTCCCTTTAAGATGGAAAAAACTGGAGACTATTTCCGAGTTACTGGAGAGATCCTGTCTGTGTTAGGAGGAGTCTACTTCTTTTTCCGAGGGATTCAGTATTTCCTGCAGAGGCGGCCGTCGATGAAGACCCTGTTTGTGGACAGCTACAGTGAGATGCTTTTCTTTCTGCAGTCACTGTTCATGCTGGCCACCGTGGTGCTGTACTTCAGCCACCTCAAGGAGTATGTGGCTTCCATGGTATTCTCCCTGGCCTTGGGCTGGACCAACATGCTCTACTACACCCGCGGTTTC

Ensembl | Human Hinterlegungsnummer

ENSG00000196689

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TRPV1(7442) , TRPV1(7442)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Gwan Hee Han et al.
Cancer genomics & proteomics, 17(3), 309-319 (2020-04-30)
Transient receptor potential vanilloid type 1 (TRPV1) has been studied in human malignancies, but has not been studied in epithelial ovarian cancer (EOC). We, therefore, investigated the significance of TRPV1 and correlation with phosphatase and tension homolog (PTEN) in EOC.
Ayumi Maeda et al.
Molecular nutrition & food research, 62(11), e1800086-e1800086 (2018-04-24)
The prevalence of type 2 diabetes mellitus (T2DM) is increasing yearly worldwide. Glycemic control is the basis for the treatment of T2DM, as it can prevent the progress of associated complications. Spices possess various health beneficial effects on humans. The
Mingming Ren et al.
Cardiovascular therapeutics, 34(6), 482-488 (2016-09-24)
Accumulating evidence showed that transient receptor potential channels play an important role in the regulation of cardiomyocyte differentiation. The vanilloid receptor 1 (VR1) is a member of the transient receptor channel super family and is expressed in cardiomyocytes. However, its
Masayoshi Kawase et al.
Scientific reports, 10(1), 9687-9687 (2020-06-18)
Despite successful clinical application of non-equilibrium atmospheric pressure plasma (APP), the details of the molecular mechanisms underlying APP-inducible biological responses remain ill-defined. We previously reported that exposure of 3T3L1 cells to APP-irradiated buffer raised the cytoplasmic free Ca2+ ([Ca2+]i) concentration
Shuo Wang et al.
Channels (Austin, Tex.), 14(1), 59-68 (2020-02-23)
The natural outcome of abdominal aortic aneurysm (AAA) is that of slow progression and ultimate rupture, then a life-threatening hemorrhage consequently. Ruptured AAA is a dramatic catastrophe and constitutes one of the leading causes of acute death in elderly men.
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.