Direkt zum Inhalt
Merck

EHU067151

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP13

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiao-Dong Li et al.
Chinese medical journal, 130(6), 717-721 (2017-03-18)
Dendritic cells are professional antigen-presenting cells found in an immature state in epithelia and interstitial space, where they capture antigens such as pathogens or damaged tissue. Matrix metallopeptidase 13 (MMP-13), a member of the collagenase subfamily, is involved in many
Rui Min Li et al.
American journal of cancer research, 8(6), 964-980 (2018-07-24)
The highly refractory nature of cervical cancer to chemotherapeutic drugs and its epithelial-to-mesenchymal transition (EMT) are the key reasons contributing to the poor prognosis of this disease. Golgi Membrane Protein 1 (GOLM1), a protein involved in the trafficking of proteins
Nobuaki Ozeki et al.
International journal of molecular sciences, 17(2), 221-221 (2016-02-11)
We established a differentiation method for homogeneous α7 integrin-positive human skeletal muscle stem cell (α7⁺hSMSC)-derived osteoblast-like (α7⁺hSMSC-OB) cells, and found that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-13-regulated proliferation of these cells. These data suggest that MMP-13 plays a potentially unique
Chia-Li M Shih et al.
Molecular biology reports, 42(7), 1225-1232 (2015-02-16)
Adipose tissue remodeling by the matrix metalloproteases (MMPs) is critical for tissue hypertrophy and obesity. MMP-13 is an important protein that is highly expressed in adipose tissue but whose potential role in adipose tissue expansion is poorly characterized. We investigated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.