Direkt zum Inhalt
Merck

EHU061331

Sigma-Aldrich

MISSION® esiRNA

targeting human PBX1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGGGCAGGTTCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCATACGGAGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGAGAGCAAAGCCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAGTTCAGCTCCATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTTCTGGATGCGCGGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTATTCCCATCTCAGCAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Changyu He et al.
Oncotarget, 8(29), 46818-46833 (2017-05-18)
Pre-B-cell leukemia homeobox 1 (PBX1) was originally identified as a proto-oncogene in human leukemia. Although this protein has been shown to contribute to cellular development and tumorigenesis, the role of PBX1 in gastric carcinoma (GC) remains unclear. In this study
Xin Wei et al.
Biochemical and biophysical research communications, 500(3), 650-657 (2018-04-22)
PBX1 was abnormally overexpressed and its intracellular localization was found to be frequently amplified in many types of cancer, including renal clear cell carcinoma. PBX1 displays oncogenic activity in several different types of cells, but little is known about how
Chiou-Hong Lin et al.
Scientific reports, 9(1), 4915-4915 (2019-03-22)
The PBX1 homeodomain transcription factor is converted by t(1;19) chromosomal translocations in acute leukemia into the chimeric E2A-PBX1 oncoprotein. Fusion with E2A confers potent transcriptional activation and constitutive nuclear localization, bypassing the need for dimerization with protein partners that normally
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.