Direkt zum Inhalt
Merck

EHU058861

Sigma-Aldrich

MISSION® esiRNA

targeting human RIPK3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGACTGACCCCTGCACAGACAGACCCCTTCCCCTCTCTGCGAAAGGACCAAGCCCCAGAAGTCACTCCATCTCCTACGGCTCGCAATTTCCAGAGGCCCCCTGGCACCTTCCAGCCTGATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGCTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Alessandra Pescatore et al.
Cell death & disease, 7(8), e2346-e2346 (2016-08-26)
Incontinentia Pigmenti (IP) is a rare X-linked disease characterized by early male lethality and multiple abnormalities in heterozygous females. IP is caused by NF-κB essential modulator (NEMO) mutations. The current mechanistic model suggests that NEMO functions as a crucial component
Diego Martin-Sanchez et al.
Scientific reports, 7, 41510-41510 (2017-02-01)
Iron deficiency has been associated with kidney injury. Deferasirox is an oral iron chelator used to treat blood transfusion-related iron overload. Nephrotoxicity is the most serious and common adverse effect of deferasirox and may present as an acute or chronic
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Xinghui Li et al.
Immunity, 50(3), 576-590 (2019-02-17)
Elevated glucose metabolism in immune cells represents a hallmark feature of many inflammatory diseases, such as sepsis. However, the role of individual glucose metabolic pathways during immune cell activation and inflammation remains incompletely understood. Here, we demonstrate a previously unrecognized

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.