Direkt zum Inhalt
Merck

EHU051621

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCCACTTCACCCTGATCCAGGCGTTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTCTTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTGGTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAAAGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yan Tan et al.
Experimental cell research, 370(2), 718-724 (2018-07-29)
Long non-coding RNA (lncRNA) are key regulatory molecules that are implicated in diverse biological processes and human diseases, including preeclampsia. However, their expression and functions in the progression of preeclampsia remains largely unclear. In this study, lncRNA DLX6-AS1 was confirmed
Pei Ma et al.
Molecular therapy. Nucleic acids, 22, 382-395 (2020-11-25)
Long noncoding RNAs (lncRNAs), genomic "dark matter," are deeply involved in diverse biological processes. The lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) is a highly participatory lncRNA; however, its roles in gastric cancer (GC) remain largely unexplored. Here, we demonstrated
Rui-Xue Sun et al.
Gene, 763, 145030-145030 (2020-08-07)
To investigate the impact and the mechanism of Gadd45α mediating p38MAPK pathway on the retinal ganglion cells (RGCs) injury in chronic ocular hypertension (COH) rats. COH model in rats were established and intraocular pressure (IOP) was tested. Retrograde labeling was
B Wang et al.
Journal of molecular cell biology, 9(4), 338-349 (2017-10-11)
Retinoic acid (RA), a bioactive metabolite of vitamin A, is a critical mediator of cell differentiation. RA blocks adipogenesis, but mechanisms remain to be established. ZFP423 is a key transcription factor maintaining white adipose identity. We found that RA inhibits

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.