Direkt zum Inhalt
Merck

EHU051511

Sigma-Aldrich

MISSION® esiRNA

targeting human LNPK

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTGAGAAGAGGCAGGTGGTGGAAGGTTCAAGTTCAGTTGGTCCCTTGCCATCAGGAAGTGTGCTTTCATCAGACAACCAGTTTAATGAAGAATCTTTAGAACACGATGTTCTTGATGATAATACAGAGCAGACAGATGACAAAATACCAGCTACAGAACAGACAAACCAAGTGATTGAAAAAGCATCTGACTCAGAGGAACCAGAGGAGAAACAAGAGACTGAGAATGAGGAAGCCTCAGTGATTGAAACCAACTCCACAGTTCCTGGAGCTGATTCTATTCCTGATCCTGAACTAAGTGGAGAATCTTTGACGGCAGAGTAGTAAATGCTTCCACGTGCCTTCAACTGGATATTTATAGTCTTACTGATGTCAGTTATTGCTTTTTCGGTGGCACTTAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jian-Bin Qiao et al.
Journal of controlled release : official journal of the Controlled Release Society, 321, 629-640 (2020-03-07)
Liver fibrosis leads to over one million deaths annually worldwide. Hepatic stellate cells (HSCs) have been identified as the main executors of liver fibrosis. Unfortunately, no drug has yet been approved for clinical use against liver fibrosis, largely because the
Kasra Khalaj et al.
Scientific reports, 7(1), 5883-5883 (2017-07-21)
Endometriosis, a major reproductive pathology affecting 8-10% of women is characterized by chronic inflammation and immune dysfunction. Human antigen R (HuR) and Tristetraprolin (TTP) are RNA binding proteins that competitively bind to cytokines involved in inflammation including: tumor necrosis factor
Genc Basha et al.
Molecular therapy. Nucleic acids, 5(9), e363-e363 (2016-09-14)
Sclerostin is a protein secreted by osteocytes that is encoded by the SOST gene; it decreases bone formation by reducing osteoblast differentiation through inhibition of the Wnt signaling pathway. Silencing the SOST gene using RNA interference (RNAi) could therefore be
Kaishun Zhao et al.
Aging, 12(10), 9125-9138 (2020-05-29)
Inflammation is an important cause of chronic obstructive pulmonary disease (COPD) and its acute exacerbation. However, the critical role of C-C chemokine receptor (CCR)1 in progression of cigarette smoke-induced chronic inflammation remains unclear. We studied CCR1 expression using immunohistochemistry, immunofluorescence
Ayaka Okamoto et al.
Biochemical and biophysical research communications, 449(4), 460-465 (2014-05-24)
An Fab' antibody against heparin-binding epidermal growth factor-like growth factor (HB-EGF) was applied to achieve advanced tumor-targeted delivery of siRNA. Lipid nanoparticles (LNP) encapsulating siRNA (LNP-siRNA) were prepared, pegylated, and surface modified with Fab' fragments of anti-HB-EGF antibody (αHB-EGF LNP-siRNA).

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.