Direkt zum Inhalt
Merck

EHU045551

Sigma-Aldrich

MISSION® esiRNA

targeting human STK39

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCACCCAATGCTAATGAAGACTACAGAGAAGCTTCTTCTTGTGCCGTGAACCTCGTTTTGAGATTAAGAAACTCCAGAAAGGAACTTAATGACATACGATTTGAGTTTACTCCAGGAAGAGATACAGCAGATGGTGTATCTCAGGAGCTCTTCTCTGCTGGCTTGGTGGATGGTCACGATGTAGTTATAGTGGCTGCTAATTTACAGAAGATTGTAGATGATCCCAAAGCTTTAAAAACATTGACATTTAAGTTGGCTTCTGGCTGTGATGGGTCGGAGATTCCTGATGAAGTGAAGCTGATTGGGTTTGCTCAGTTGAGTGTCAGCTGATGTATGTCCCTTGATGTCACCCTGATCTGTCATGCCCCACCGCCACCCCTACTCCCTTCAACCCTCCCTCTTTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ye Bi et al.
Frontiers in physiology, 11, 638-638 (2020-07-28)
SPS1-related proline/alanine-rich kinase (SPAK) plays important roles in regulating the function of numerous ion channels and transporters. With-no-lysine (WNK) kinase phosphorylates SPAK kinase to active the SPAK signaling pathway. Our previous studies indicated that WNK kinases regulate the activity of
Chih-Hao Shen et al.
BMC pulmonary medicine, 21(1), 58-58 (2021-02-17)
Hyperoxia downregulates the tight junction (TJ) proteins of the alveolar epithelium and leads to barrier dysfunction. Previous study has showed that STE20/SPS1-related proline/alanine-rich kinase (SPAK) interferes with the intestinal barrier function in mice. The aim of the present study is
Ken Yamada et al.
ACS chemical biology, 11(12), 3338-3346 (2016-10-08)
Protein kinases are known for their highly conserved adenosine triphosphate (ATP)-binding site, rendering the discovery of selective inhibitors a major challenge. In theory, allosteric inhibitors can achieve high selectivity by targeting less conserved regions of the kinases, often with an
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.