Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU043401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATTTTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTCTGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATTGGGTAGCAGGAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCAATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTGTAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGCGTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTC

Ensembl | Human Hinterlegungsnummer

ENSG00000081479

NCBI-Hinterlegungsnummer

NM_004525

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LRP2(4036) , LRP2(4036)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuan Gao et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7684-7693 (2019-03-21)
Osteoblast differentiation of human mesenchymal stem cells (hMSCs) is stimulated by 1α,25-dihydroxycholecalciferol [1α,25(OH)2D3] and 25-hydroxycholecalciferol [25(OH)D3]; the latter's effects require intracellular hydroxylation to 1α,25(OH)2D3. Thus, hMSCs are both a source of and target for 1α,25(OH)2D3. Megalin is a transmembrane receptor
Aurélien Briens et al.
Cell discovery, 3, 17001-17001 (2017-04-19)
Plasminogen activation is involved in many processes within the central nervous system, including synaptic plasticity, neuroinflammation and neurodegeneration. However, the mechanisms that regulate plasminogen activation in the brain still remain unknown. Here we demonstrate that astrocytes participate in this regulation
Rohit Upadhyay et al.
JCI insight, 5(14) (2020-06-17)
Free light chains (FLCs) induce inflammatory pathways in proximal tubule cells (PTCs). The role of TLRs in these responses is unknown. Here we present findings on the role of TLRs in FLC-induced PTC injury. We exposed human kidney PTC cultures
Kimberly R Long et al.
American journal of physiology. Renal physiology, 318(3), F851-F859 (2020-02-19)
Albuminuria is frequently associated with proximal tubule (PT) cytotoxicity that can feed back to cause glomerular damage and exacerbate kidney disease. PT cells express megalin and cubilin receptors that bind to and internalize albumin over a broad concentration range. How
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.