Direkt zum Inhalt
Merck

EHU037471

Sigma-Aldrich

MISSION® esiRNA

targeting human ECT2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTGGATTCTCCGGAATTTGAAAATGTATTTGTAGTCACGGACTTTCAGGATTCTGTCTTTAATGACCTCTACAAGGCTGATTGTAGAGTTATTGGACCACCAGTTGTATTAAATTGTTCACAAAAAGGAGAGCCTTTGCCATTTTCATGTCGCCCGTTGTATTGTACAAGTATGATGAATCTAGTACTATGCTTTACTGGATTTAGGAAAAAAGAAGAACTAGTCAGGTTGGTGACATTGGTCCATCACATGGGTGGAGTTATTCGAAAAGACTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGTACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTAGGTACTCCAATTATGAAGCCAGAATGGATTTATAAAGCTTGGGAAAGGCGGAATGAACAGGAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Zeinab Kosibaty et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 551-567 (2018-12-14)
Epithelial cell transforming sequence 2 (ECT2), a guanine nucleotide exchange factor, is predominantly localized in the nucleus of non-transformed cells and functions to regulate cytokinesis. ECT2 is also localized in the cytoplasm of cancer cells. Aberrant cytoplasmic expression of ECT2
J Sebastián Gómez-Cavazos et al.
Current biology : CB, 30(16), 3101-3115 (2020-07-04)
Cytokinesis partitions the cell contents to complete mitosis. During cytokinesis, polo-like kinase 1 (PLK1) activates the small GTPase RhoA to assemble a contractile actomyosin ring. PLK1 is proposed to pattern RhoA activation by creating a docking site on the central
Qi Zhang et al.
Theranostics, 10(23), 10769-10790 (2020-09-16)
Rationale: A number of guanine nucleotide exchange factors (GEFs) including epithelial cell transforming factor ECT2 are believed to drive carcinogenesis through activating distinct oncogenic GTPases. Yet, whether GEF-independent activity of ECT2 also plays a role in tumorigenesis remains unclear. Methods:

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.