Direkt zum Inhalt
Merck

EHU037241

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAGAGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAACCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCAAACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATGGCGTCTGCTCTGGTGGCTTAAGTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

S Muppala et al.
Oncogene, 36(36), 5189-5198 (2017-05-10)
TGF-β is a multifunctional cytokine affecting many cell types and implicated in tissue remodeling processes. Due to its many functions and cell-specific effects, the consequences of TGF-β signaling are process-and stage-dependent, and it is not uncommon that TGF-β exerts distinct
Zheng Jiang et al.
Journal of biochemistry, 165(4), 317-322 (2018-12-12)
Radiotherapy is the major treatment modality for malignant glioma. However, the treatment response of radiotherapy is suboptimal due to resistance. Here we aimed to explore the effect and mechanism of Mothers against decapentaplegic homologue (SMAD3) silencing in sensitizing malignant glioma
Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Nao Hiwatashi et al.
The Laryngoscope, 127(9), E308-E316 (2017-05-26)
Recent reports highlight the efficacy of small interfering RNA (siRNA) targeting SMAD3 to regulate transforming growth factor β (TGF-β)-mediated fibroplasia in vocal fold fibroblasts. The current study sought to investigate SMAD3 expression during wound healing in vivo and quantify the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.