Direkt zum Inhalt
Merck

EHU029161

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM32

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGCTGACAGTAGTCGCAAGGAAATTCTCCATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTGGGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATCAAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAGGGGATGAGAAATTATCAGTTTCTTCTGCTCCCAAGCCAACTTCCCTTCCCTTAGTTCTTGGTTGTTAGTGGCACATGCAGAATAGACTCAGCCTATGTCCTGATTCCAGCTGGGTAGTTCTAGAACTTCAGAAGCTCCATCTTTTAATGTTTTTATTTGTTATGTCCCCCTCCCCGCTTCCCACCTAAATTTAGAGCTTTAAAAGATGCACTGCCCAAATAGGAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hao Cui et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 801-811 (2017-09-28)
Epithelial cells play important roles as a critical barrier in protecting the cornea from microbial pathogens infection. In this study, we were aiming to investigate the role of E3 ubiquitin ligase tripartite motif protein 32 (TRIM32) in corneal epithelial cells
Maria Angeliki S Pavlou et al.
Molecular neurobiology, 54(6), 4257-4270 (2016-06-25)
Alpha-synuclein is an abundant neuronal protein which has been associated with physiological processes like synaptic function, neurogenesis, and neuronal differentiation but also with pathological neurodegeneration. Indeed, alpha-synuclein (snca) is one of the major genes implicated in Parkinson's disease (PD). However
Sarah Gilbertson et al.
eLife, 7 (2018-10-04)
Alterations in global mRNA decay broadly impact multiple stages of gene expression, although signals that connect these processes are incompletely defined. Here, we used tandem mass tag labeling coupled with mass spectrometry to reveal that changing the mRNA decay landscape
Hideki Izumi et al.
Cancer research, 74(19), 5620-5630 (2014-08-08)
Asymmetric cell division (ACD) is a physiologic process during development and tissue homeostasis. ACD produces two unequal daughter cells: one has stem/progenitor cell activity and the other has potential for differentiation. Recent studies showed that misregulation of the balance between

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.