Direkt zum Inhalt
Merck

EHU026851

Sigma-Aldrich

MISSION® esiRNA

targeting human TBC1D9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGTGGACCAAGGTGTCTTTGAGGAGCTAGCACGAGACTACGTCCCACAGCTGTACGACTGCATGCAAGACCTGGGCGTGATTTCCACCATCTCCCTGTCTTGGTTCCTCACACTATTTCTCAGTGTGATGCCTTTTGAGAGTGCAGTTGTGGTTGTTGACTGTTTCTTCTATGAAGGAATTAAAGTGATATTCCAGTTGGCCCTAGCTGTGCTGGATGCAAATGTGGACAAACTGTTGAACTGCAAGGATGATGGGGAGGCCATGACCGTTTTGGGAAGGTATTTAGACAGTGTGACCAATAAAGACAGCACACTGCCTCCCATTCCTCACCTCCACTCCTTGCTCAGCGATGATGTGGAACCTTACCCTGAGGTAGACATCTTTAGACTCATCAGAACTTCCTACGAGAAATTCGGAACTATCCGGGCAGATTTGATTGAACAGATGAGATTCAAACAGAGACTGAAAGTGATCCAGACGCTG

Ensembl | Human Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoqian Yang et al.
Pharmaceutical research, 32(6), 2097-2109 (2014-12-18)
Approaches for the synthesis of biomaterials to facilitate the delivery of "biologics" is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on
Tao Wang et al.
Theranostics, 5(12), 1456-1472 (2015-12-19)
Understanding the molecular basis of drug resistance and utilising this information to overcome chemoresistance remains a key challenge in oncology. Here we report that survivin, a key protein implicated in drug resistance, is overexpressed in cancer stem cell pool of
Runbi Ji et al.
Cell cycle (Georgetown, Tex.), 14(15), 2473-2483 (2015-06-20)
Mesenchymal stem cells (MSCs) play an important role in chemoresistance. Exosomes have been reported to modify cellular phenotype and function by mediating cell-cell communication. In this study, we aimed to investigate whether exosomes derived from MSCs (MSC-exosomes) are involved in
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Xia Wen et al.
Toxicological sciences : an official journal of the Society of Toxicology, 141(2), 475-483 (2014-07-13)
Paraquat is a herbicide that is highly toxic to the lungs and kidneys following acute exposures. Prior studies have demonstrated that the organic cation transporter 2 and multidrug and toxin extrusion protein 1 contribute to the urinary secretion of paraquat

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.