Direkt zum Inhalt
Merck

EHU023751

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCCAATCTTCATTGCTCAAGTGTCTGAAGCAGCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dong-Dong Zhu et al.
Cardiovascular diabetology, 15, 42-42 (2016-03-06)
Previous studies have shown that high glucose (HG) induced endothelial cell (EC) damage via a phenotypic transition of EC. There is increasing evidence suggesting the role of inflammatory cytokines in mediated HG-induced EC damage. However, little is known about the
Dhivya Thiyagarajan et al.
PloS one, 10(6), e0129485-e0129485 (2015-06-13)
We have demonstrated that the renal endonuclease DNaseI is up-regulated in mesangial nephritis while down-regulated during progression of the disease. To determine the basis for these reciprocal DNaseI expression profiles we analyse processes accounting for an early increase in renal
Ravi S Keshari et al.
PloS one, 7(10), e48111-e48111 (2012-10-31)
Neutrophils (PMNs) and cytokines have a critical role to play in host defense and systemic inflammatory response syndrome (SIRS). Neutrophil extracellular traps (NETs) have been shown to extracellularly kill pathogens, and inflammatory potential of NETs has been shown. Microbial killing
Sambasivan Venkatasubramanian et al.
PLoS pathogens, 11(2), e1004617-e1004617 (2015-02-07)
In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.