Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU016451

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAACAAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACATCAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTCATT

Ensembl | Human Hinterlegungsnummer

ENSG00000196396

NCBI-Hinterlegungsnummer

NM_002827

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PTPN1(5770) , PTPN1(5770)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Akarawin Hongdusit et al.
Nature communications, 11(1), 788-788 (2020-02-09)
Protein tyrosine phosphatases regulate a myriad of essential subcellular signaling events, yet they remain difficult to study in their native biophysical context. Here we develop a minimally disruptive optical approach to control protein tyrosine phosphatase 1B (PTP1B)-an important regulator of
Caroline E Nunes-Xavier et al.
Diagnostic pathology, 14(1), 134-134 (2019-12-16)
Protein tyrosine phosphatases (PTPs) regulate neuronal differentiation and survival, but their expression patterns and functions in human neuroblastoma (NB) are scarcely known. Here, we have investigated the function and expression of the non-receptor PTPN1 on human NB cell lines and
Liza D Morales et al.
PloS one, 9(5), e97104-e97104 (2014-05-09)
To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)
Samuel Legeay et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110200-110200 (2020-05-18)
Diabetes notably increases the risk for endothelial dysfunction, a main precursor for microvascular complications. While endoplasmic reticulum stress (ERS) and protein tyrosine phosphatase 1B (PTP1B) have been associated with endothelial dysfunction in resistance vessels, whether these mechanisms also contribute to
Xiaoyan Zhang et al.
Scientific reports, 5, 12987-12987 (2015-08-12)
Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.