Direkt zum Inhalt
Merck

EHU007971

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGTCTCCCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGAAGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAGCCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTCCAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Corina T Madreiter-Sokolowski et al.
Oncotarget, 8(46), 80278-80285 (2017-11-09)
Cancer cells have developed unique strategies to meet their high energy demand. Therefore, they have established a setting of Ca
Anand Kumar Gupta et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 5087-5101 (2017-08-03)
In visceral leishmaniasis, we found that the antileishmanial drug Amp B produces a higher level of IL-1β over the infected control. Moreover, administering anti-IL-1β antibody to infected Amp B-treated mice showed significantly less parasite clearance. Investigation revealed that
Rui Zhang et al.
BioMed research international, 2020, 6537371-6537371 (2020-09-17)
As a common disorder, acute kidney injury (AKI) is characterized by high mortality and morbidity, and current therapeutic options for AKI remain limited. Irisin, a muscle factor, plays an important role in metabolic disorders. However, the role of irisin in
Jin Hee Lee et al.
Oncology letters, 20(6), 374-374 (2020-11-07)
The uncoupling protein-2 (UCP2) serves a role in tumor aggressiveness and anticancer resistance, which is considered to be associated with its ability to attenuate reactive oxygen species (ROS) production. We hypothesized that UCP2 may protect cancer cells from elesclomol-induced cytotoxicity
Rebecca F Hough et al.
JCI insight, 4(3) (2019-02-08)
Acid aspiration, which can result from several etiologies, including postoperative complications, leads to direct contact of concentrated hydrochloric acid (HCl) with the alveolar epithelium. As a result, rapid endothelial activation induces alveolar inflammation, leading to life-threatening pulmonary edema. Because mechanisms

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.