Direkt zum Inhalt
Merck

EHU003961

Sigma-Aldrich

MISSION® esiRNA

targeting human USP13

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGATCGCCTGATGAACCAATTGATAGACCCATCAGACATCGATGAGTCATCAGTGATGCAGCTGGCCGAGATGGGTTTCCCGCTGGAAGCATGTCGCAAGGCTGTGTACTTCACTGGAAATATGGGCGCCGAGGTGGCCTTCAACTGGATCATTGTTCACATGGAAGAGCCAGATTTTGCTGAGCCGCTGACCATGCCTGGTTATGGAGGGGCAGCTTCTGCTGGAGCCTCTGTTTTTGGTGCTTCTGGACTGGATAACCAACCTCCAGAGGAAATCGTAGCTATCATCACCTCCATGGGATTTCAGCGAAATCAGGCTATTCAGGCACTACGAGCAACGAATAATAACCTGGAAAGAGCACTGGATTGGATCTTTAGCCACCCTGAGTTTGAAGAAGACAGTGATTTTGTGATTGAGATGGAGAATAATGCCAATGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yue Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 114, 108831-108831 (2019-04-16)
USP13 is emerging as a potential target in cancer therapy. However, the effect of USP13 on tumor progression is controversial. Here we focused on non-small cell lung cancer (NSCLC), a common cancer with high mortality, and studied the role of
Yuning Liao et al.
Journal of experimental & clinical cancer research : CR, 38(1), 157-157 (2019-04-13)
Prostate cancer (PCa) remains a challenge worldwide. Due to the development of castration-resistance, traditional first-line androgen deprivation therapy (ADT) became powerlessness. Epidermal growth factor receptor (EGFR) is a well characterized therapeutic target to treat colorectal carcinoma and non-small cell lung
Xiaoguang Fang et al.
The Journal of experimental medicine, 214(1), 245-267 (2016-12-08)
Glioblastoma is the most lethal brain tumor and harbors glioma stem cells (GSCs) with potent tumorigenic capacity. The function of GSCs in tumor propagation is maintained by several core transcriptional regulators including c-Myc. c-Myc protein is tightly regulated by posttranslational
Shan Gao et al.
Frontiers in cell and developmental biology, 8, 587389-587389 (2020-11-17)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer death worldwide. The activation of the toll-like receptor 4/myeloid differentiation primary response gene 88/nuclear factor-κB (TLR4/MyD88/NF-κB) pathway contributes to the development and progression of HCC. The ubiquitin-proteasome system regulates

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.