Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU002791

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB2, SERPINB10

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTCAGAACCCCAGGCAGTAGACTTCCTAGAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAGGCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCGGCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATAGAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTGTTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTGCTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAA

Ensembl | Human Hinterlegungsnummer

ENSG00000197632

NCBI-Hinterlegungsnummer

NM_002575

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SERPINB2(5055) , SERPINB2(5055)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Eleonora Longhin et al.
Archives of toxicology (2018-07-11)
Exposure to particulate matter (PM) has been related to the onset of adverse health effects including lung cancer, but the underlying molecular mechanisms are still under investigation. Epithelial-to-mesenchymal transition (EMT) is regarded as a crucial step in cancer progression. In
Ziqi Meng et al.
International immunopharmacology, 81, 106028-106028 (2019-12-06)
To investigate the effect of miR-200c/PAI-2 on macrophage polarization into M2-type TAMs in TNBC. PAI-2 expression in MDA-MB-231con, MDA-MB-231miR-200ab and MDA-MB-231miR-200c breast cancer cells was evaluated by RT-PCR and immunofluorescence (IF), while the expression of the TAM marker F4/80 and
Tiefeng Jin et al.
Oncotarget, 8(20), 32769-32782 (2017-04-22)
The microRNA-200 (miR-200) family is associated with tumor metastasis and poor patient prognosis. We found that miR-200c/141 cluster overexpression upregulated SerpinB2 in the MDA-MB-231 triple-negative (TN) breast cancer cell line. We observed transcription factor (c-Jun, c-Fos, and FosB) upregulation, nuclear
Lei Hu et al.
Cell death & disease, 11(3), 172-172 (2020-03-07)
Mesenchymal stem cell (MSCs) transplantation has been used to treat Sjögren's syndrome (SS) based on the immunoregulatory properties of MSCs. However, the effectiveness need improving and its underlying intrinsic mechanisms remain largely unknown. Here, we show that Id3 is upregulated
Na-Hee Lee et al.
Cell death & disease, 9(7), 724-724 (2018-06-22)
The toxicological evaluation of potential drug candidates is very important in the preclinical phase of drug development. Toxic materials may cause serious decline in stem cell function and loss of stemness. Indeed, we found that toxic exposure more profoundly suppressed
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.