HLTUD002C
MISSION® Lenti microRNA Inhibitor
cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences
Synonym(s):
Tough Decoy, TuD
About This Item
Recommended Products
Quality Level
product line
MISSION®
form
liquid
concentration
≥1x106 VP/ml (via p24 assay)
mature sequence
CGGUACGAUCGCGGCGGGAUAUC
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
Looking for similar products? Visit Product Comparison Guide
General description
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other Notes
Legal Information
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service