Skip to Content
Merck
All Photos(1)

Key Documents

EMU196671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmga2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCATTCGTATAAGAAAAGCATTGTGTGTGACTCTGTGTCCACTCAGATGCCACCCCCACCATGATCATAGAAAATCTGCTTAGGACACCAAAGATGAGAACTAGACACTACTCTCCTTTCTTTGTGTATAATCTTGTAGACACTTACTTGATTTTTTTTTCTTTTTTTACTTTTCAATTCTGAATGAGACAAAATGCTGGTGTATCTTTTCATACAGCTAGCAAACCAGAATAGGTTATGCTCGTTTTTTGCTTTGTTTTGTTTTTCAAAAAGGGAAGTAAACGAGAACCGTTGACTCCTCCATTTATGGACTCATACACAGCAGCAGGAGTGATAAGCCCACAAGCTCTCTTTCCCGCCTCGGGAAATCTACACAGCCAAAAGCCACTTAGCCATAAATGACACTTGTCAGCCTTGAAGCATCGGAGATAACTAGCTGAGTAAAATGATCCTGTTTTGGAATTTAATGAAAAGGTTAACAGTACCCAATGAACCCACCCAAGTGATGAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chun-Yu Kao et al.
PeerJ, 4, e1683-e1683 (2016-02-20)
High Mobility Group AT-hook 2 (HMGA2) is a nonhistone chromatin-binding protein which acts as a transcriptional regulating factor involved in gene transcription. In particular, overexpression of HMGA2 has been demonstrated to associate with neoplastic transformation and tumor progression in Colorectal
Silvia Parisi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(3), 1046-1058 (2016-12-07)
Lin28 RNA-binding proteins play important roles in pluripotent stem cells, but the regulation of their expression and the mechanisms underlying their functions are still not definitively understood. Here we address the above-mentioned issues in the first steps of mouse embryonic
Zhouying Wu et al.
British journal of haematology, 171(5), 818-829 (2015-09-26)
Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
You-You Xia et al.
Biochemical and biophysical research communications, 463(3), 357-363 (2015-05-31)
Epithelial-mesenchymal transition (EMT) is associated with invasion and metastasis of cancer cells. High-mobility group AT-hook 2 (HMGA2) has been found to play a critical role in EMT in a number of malignant tumors. However, whether HMGA2 regulates the EMT in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service